Human Variation & Race Blog

Cold weather plays a major role in how people live and survive. The cold is an environmental stress that negatively impacts the survival of humans because we can develop hypothermia, which is life threatening to humans. Living in the cold is hard because you can not be outside for a very long time because our bodies are not made to keep us warm. If humans stay out in the cold for to long our core body temperature will drop and the hypothalamus will fail causing death. This environmental stress would impact humans trying to eat, live, and sleep. People living in the cold are usually depleted of vitamin D and even experience affected oxygen levels. It makes survival hard because it limits time for being outside trying to find food and it makes living harder because you must consistently worry about keeping your body warm. 

           A short-term adaption to the cold would be shivering. Shivering is a homeostatic function in response to the cold in warm-blooded animals. Humans shivering reflex is triggered to maintain homeostasis.

A facultative adaption to the cold could be gaining weight to keep warmer. By eating more foods, the bodies Basal Metabolic Rate will increase, which will produce body heat.

Developmental adaptions to the cold weather are body size and shape. According to Allen’s Rule, people with shorter, smaller limbs are going to be able to maintain more body heat. The shorter limbs make the body more condensed, which then have smaller surface area. Having a smaller surface area compared to body mass will help the body heat not be lost to the environment as easily.

Cultural adaptions to the cold would be nutrition. People living in
colder climates are going to consume much more carbohydrates. Carbs are complex organic compounds that are the main source of fuel for the metabolic process. Carbs take a long time to be broken down, which gives people long lasting energy and body heat.

              Studying human variation from this perspective is beneficial because it can help us understand why people in different regions and cultures live the way they do. This information is very useful because it can tell us so many things from why someone might look the way they do physically, why they might eat certain foods, and why they might live longer in one region rather than in another. For example, if you are teaching young children about different cultures around the world, you can use this information to explain why they are different, which is a lot of the time due to the environment. You can use the information in a productive way by analyzing your own environment and seeing what adaptions your own body has made, this helps one understand why they might live a certain way.

              In my opinion since race is a social construct it is hard for me to use it to understand the variation of adaptions. Using race by saying one’s skin is darker because they live in hotter climates and they produce more melanin for skin protection doesn’t make sense. This doesn’t make sense because even if your black and were born in the artic your skin wouldn’t magically turn white. Skin color adaptions have taken thousands of years to adapt and change. So, I guess using race to understand how our human ancestors lived and adapted to the environment makes more since, but it doesn’t make sense to use the skin colors we have today to understand variation of adaptions. Studying environmental influences on adaptions is a better way to understand human variation because the color of our skin does not determine where we live. Not studying skin color but studying other important adaptions like nutrition, oxygen levels, or culture can help one better understand how the environment might affect a person. Looking at the environmental factors can give someone insight on why some one lives the way they do. Skin color does not determine all the factors.

Language Blog

The language experiment this past weekend went really unexpected and was hilarious. Part one of the experiment where I wasn’t allowed to talk reminded me of charades. I felt like I couldn’t get any points across because he had no clue what my body movements meant. It was a little frustrating but over all funny. My partners experience was that he could not take me seriously because he didn't know what I was trying to explain to him. Also, he didn't know where to take the conversation since I wasn’t communicating clearly. He felt that it was hard. The experiment was not difficult, but trying to communicate without language is extremely difficult. My partner completely altered the way he communicated with me by speaking slower and describing things more in depth. Also, he kept repeating things making sure he understood what I was trying to say to him.
    My partner was completely in control of this experimental conversation. Since he was the only one that could use language and make a clear point he led the conversation and changed the topics, which there were only two. My partner asked all the questions because it was to difficult for me to ask questions with just hand motions. My partner definitely had the power in this conversation. It felt like I couldn’t communicate anything, and even if he would slightly start to understand what I was saying it still wasn't what I really meant.
    If my partner was from a culture that used spoken language and my culture didn’t, my partners culture would have a huge advantage with communicating complex ideas. The attitudes that I think the speaking culture would have on the non-speaking culture is that they would feel superior. I believe the speaking culture would think that the non-speaking culture is ill-advised and unable to efficiently function. I believe that a modern situation that resembles this concept could be the deaf culture and the speaking culture. This situation does not mirror the concept but does resemble the disconnect a lot of people have with the deaf culture. People that can speak have such a higher advantage in getting a job or so that’s what people assume. The deaf community are not inferior but have harder times communicating complex ideas to everyone. They use american sign language which a lot of speaking people have learned to use, but unfortunately a big chunk of the speaking culture does not. I believe this disconnect causes these individuals to feel different and misunderstood, maybe like how my partner and I felt in this experiment.
      Part two of the language experiment was not as hard as the first one but still difficult. I am a very enthusiastic talker and I love to use my hands and facial expressions to get ideas across, so this experiment was rather difficult for me. When I was speaking in a monotone voice it changed my whole personality and changed the whole “vibe” of the conversation. My partner, who I know very well, felt that any response he had wasn’t important to me because I didn’t have any enthusiastic responses back. His experience to the experiment was that he could not hold a conversation well with a person that has monotone and that doesn’t express themselves with body language or facial expressions. I found part 2 easier than part 1 but still difficult because it was the opposite of what comes natural to me. The conversation was just not making sense after a while. My partner gave shorter answers that were unenthusiastic and uncomfortable due to the lack of my body language. He had no difficulty understanding what I was saying, but he felt that he couldn’t understand my demeanor. He expressed that it was hard to fully have a real conversation like that because he felt my demeanor was sad and annoyed.
      This experiment has completely opened my eyes to how important “signs” our in our language. I use signs and body language everyday to describe things and help someone better understand what I’m saying. I can see how effective it is to use signs when trying to make a point to someone. When reading someone’s body language you can receive all sorts of information like if something’s wrong, someone’s mad at you, what something looks like, or how to do something. All these things are valuable information that could help communicate one's feelings, ideas, and demonstrations.
     The adaptive benefit of having the ability to read body language is so important in helping one survive. This adaptive benefit could be used to identify if someone is friendly or an intruder, which could help someone stay alive and protect themselves. For example, if someone sees a person rushing toward them with their hands in a fist, the person with this ability can read the person's body language and inquire that they might be trying to hurt them and choose to run away and protect themselves. This adaptive ability could potentially help someone stay alive. Also, it can help someone obtain resources by making it easier for the person to understand where to get resources. For example, if the person needs to know where to get something and someone gives them directions with pointing, he will be able to understand the direction and follow it to the resources he was looking for. This ability can help someone reproduce successfully by reading if the person wants to engage in sexual intercourse. Also by reading the body language of the person and identifying what sexual touches could help the person engage in sexual activities, which will help them have sex and reproduce.
     I’m sure there are people out there that have difficulty reading body language. What comes to mind is people on the autism spectrum who sometimes have difficulty reading “social cues” from people. I believe there are benefits to not being able to read body language because in a lot of instances you could read the body language wrong. For example, if a person looks and acts mad, but is indeed not mad, just looks that way, it would be beneficial not to read the body language but just ask the person specifically what’s going on. There are also many situations where the information you read from someone body language is not reliable. For example, if someone is crying, and you ready the body language of someone being sad, but instead their actually crying of happiness, it may be beneficial not to read the sign. In this instance body language did not give you “reliable” information. Over all this experiment really put into perspective how much our culture relies on these body cues and sign languages to express ourselves.

Piltdown Man

        In 1912 Charles Dawson, an archaeologist, had found part of a skull that had seemed more human- like. He found this skull in Pleistocene gravel beds near Piltdown village in Sussex, England. Charles Dawson said that he had found the skull of a human-like ancestor, proclaiming it was an ancestor between an ape and a man. The scientific significance if this were true would have been huge. This skull could have provided us with evidence that we do have relation with apes. Also, could have been the earliest known sapient man. It would’ve also changed the way we understand human evolution, because the hoax skull provided evidence that this human ancestor developed a large brain before walking upright. The effects that this had on the scientific community was that they were excited about the find. Otto Schoetensack, who discovered the Heidelberg fossils, said that this find was the best evidence for an ape-like ancestor of modern humans.On the other hand, in 1923 Franz Weidenreich examined the find and reported that it was a modern human cranium and an orangutan jaw with filed-down teeth. Even though there were people saying otherwise, most of the scientific community believed this skull was authentic. Especially when the Scheffield Park finds, which were three fragments of a second skull, was taken as proof of the authenticity of the Piltdown skull. In 1953, Joseph Weiner and Kenneth Oakley examined the Piltdown fossils and found that the teeth had been purposely ground down with something abrasive. They did chemical analysis, including an improved fluorine test and found that the jaw and were not the same age as the skull and were not even fossils, just very old bones. They found that some bones had been stained with chemicals and some with painted to make them look like the color of the soil. After they discovered this they knew the Piltdown fossil collection was a hoax. On November 20, 1953, they reported their findings to the Natural History Museum and the news was out the next day. The response it received from scientists was that Dawson had been the man behind the hoax. The scientists who discovered that it was hoax said that the scientists 40 years before them had been victims of this elaborate hoax.

        Yes we are all human and we all make mistakes and sometimes believe what we want to believe without investigating. Some faults that came into play here was seeing and believing. The United Kingdom human evolution research community wanted to believe so badly that England was the site of early human evolution. I believe another mistake made by scientists was that they did not conduct much enough investigations on the skull fragments. The science community only seemed to want to prove it was authentic rather than it not be. It became widely accepted during that time, and scientists blindly believed their colleagues and peers. These faults negatively impacted the science process because it was so easily tricked and obviously proven to be unsuccessful. The trust in scientists decreased and now there are many processes that fossils have to go through to be deemed real and authentic.

Some positive aspects of the scientific process that helped prove the piltdown man was a fraud was examining data and conducting an experiment . Kenneth Oakley tried to authenticate the piltdown man by doing a new chemical analysis called fluorine testing, which the fossil bones absorb the fluorine from soil and water. The piltdown remains had similar amounts of fluorine suggesting they belonged together, but appeared to be only 50,000 years old instead of 500,000 years old. This proved inaccuracy in what Dawson had told the public. Also, Joespeh Weiner used the scientific process of observing and conducting research on the specimens. He noticed that the fossil tooth's were purposely ground down. Oakley and Wiener decided to conduct another experiment, doing another chemical analysis, an improved fluorine test, and found the jaw and teeth were not the same age as the skull. They also did a second test using nitrogen analysis, which confirmed the first test. Also, evidence of it not being real was tested by recreating the abrasion of teeth with a file, which proved the teeth were filed down by someone. A bunch of visual observations concluded that skull clearly did not come from one animal. They also tested the material of the jaw bone, which was found artificially stained with potassium dichromate to make it appear older. Most of the scientific processes that we use today they used to prove that it was a fraud.

Artificial intelligence testing hypothesis and having hard cold evidence is taking the “human” factor from science. Then again are human characteristics are the reasons we choose to discover things and figure out the natural world around us. I believe we need the human factor because we are the curious beings that want to discover the truths of our world. We need these errors so that we can learn from them and prosper.

The lesson that i can learn from this historical event is that just because it seems real and looks real doesn't mean its real. For something to be proven the truth or “authentic” it cant just look like the part it needs to be proven and tested until it holds enough evidence. Also, just because your smarty pant peers seem to believe something to be true doesn't always mean you should trust them. We should always follow are scientific processes and test, test, and test!

Homologus and Analogus Traits

      Two species that possess the homologus trait are humans and monkeys. Humans are bipedal primate mammals that are considered to be one of the smartest species to ever live. Humans are "us", we are currently defined as the Homo sapiens species.  Monkeys are non-hominoid simians, which consist of 260 known living species. Monkeys generally possess tails and live in or by trees. Monkeys come in all different shapes and sizes just like humans do. Monkeys and humans share many similar characteristics like being extensively social in their own environment, and they share many differences like humans habituating all parts of the world and monkeys usually only habituating forest regions where lots of tree coverage is available.



The homologus trait between monkeys and humans are that they have tails, which is an extension of

the torso. The tails that monkeys possess are called prehensile tails which act as an extra limb for the monkeys. This "limb" allows the monkey to grasp objects, swing from branches, hold onto things, and ward off insects.  Humans possess a very similar feature known as the coxxyx or the tailbone. The coxxyx was thought to have once been a fully formed tail. The human tailbone is an extension of the torso and is made of "rudimentary vertebrae" and is often called a vestigial structure. The coxxyx does not have the same function as the monkey's tail. The human tailbone serves as a muscle attachment for our lower limbs as well as helps in balance and support for when a person sits. The obvious difference in these structures are size, the human tailbone generally measures less than one inch in length while generally monkeys tail bones could measure from 2 inches all the way to 23 inches. Monkeys tails display a series of tail vertebrae while humans tailbone is loosely fused bones that are attached to the sacrum. These homologus traits exhibit differences between humans and monkeys mainly because of environmental factors. Monkeys have made use for the tails due to their environment, using it to grasp and hold onto branches as well as for climbing and agility. Humans, on the other hand, did not need much use for this longer tail because of the environment, they became bipedal and probably had no use for a tail anymore.
      Paleontologist's working in Tanzania have discovered the oldest known fossils from two major primate groups — Old World monkeys and apes which include humans. This study recovered a lone tooth and jaw fragment with three teeth from a site in Rukwa in southwestern Tanzania. They dated geological nearby rocks and found out that the fossils are 25.2 million years old, which is older than any other example from either primate group. This fossil trove “fills in a roughly 10-million-year gap in primate evolution,” says John Fleagle, an anthropologist at Stony Brook University in New York. This discovery also confirms the fossil record analyses of mutations in DNA that can be traced back to estimate how long ago two species diverged, which suggests that old world monkeys and apes split from their common ancestor 25 million to 30 million years ago. This discovery proves that approximately 30 million years ago monkeys and human ancestors the "apes" split from their common ancestor, which was generally said to resemble a primate-like  mammal species that possessed a tail of some sort. With this evidence it would seem that this unknown common ancestor possessed the homologus trait but then due to many factors this species diverged into two new species carrying with them this homologus trait but with different structures and functions.

     Two different species that possess the analogus trait is a dolphin and a horse. Dolphins are aquatic mammals that have teeth. There are 39 species of oceanic dolphins classified in four genus, but these numbers continue changing with new discoveries. There are even small amounts of dolphins that inhabit freshwater rivers. Dolphins have smooth, rubbery skin that usually is a mixture of black, white, and gray. They have two flippers or fins on their sides, a triangular fin on the back, and a large layer of blubber beneath their skin. On the other hand, Horses are odd-toed ungulate mammals belonging to the taxonomic family Equidae. Their average height is 4 ft. to 6ft. and their average weight is 840lbs to 2,200lbs. They have long tails, short hair, muscular torsos, long thick necks and elongated heads. Due to domestication they are found all over the world.
   
          The analogus trait of each species is their limbs.  A dolphins flipper or limb measures 11-19 inches and are curved back. A horse's limbs are made of dozens of bones, ligaments, muscles, and tendons that support the weight of the body. Both a horse and dolphin possess similarities in their structure, for example, they both contain a humerus, radius, ulna, carpals, metacarpals, and phalanges. They have complete difference in size and shape, but are used for the same function and motion

whether it be in water or land.  This similar function is for moving and steering. Both horses and dolphins use their limbs for moving, steering, and even balancing across the ocean for the dolphin or land for the horse. This analogus trait between these species exhibit similarities because both are needed for them to be able to move around areas properly and thrive. The common ancestor of these two species could definitely have had possessed this analogus trait. Scientists believe that the earliest ancestors of dolphins were not marine creatures but were terrestrial animals. The evidence is that dolphins have to come to the surface of water to get air. Since ancestors of the horse were terrestrial maybe this analogus trait was possessed by the common ancestor o these two species because they were in similar environments and those certain bones were needed for different functions and many survival. The function of these limbs are ultimately to move and steer which in any environment seems helpful. We know these traits are analogus because they have the same function but belong to a different class of vertebrates so that must mean their evolutionary line must be different.

Week 2 bonus

How much should “opinion” come into play in science and in science education?  Can opinion play a positive role or a negative role in science?

In my opinion, "opinion" should not come into play at all in science and science education. I personally went to a catholic school where opinion mattered a lot in the education system specifically science. Instead of introducing us to theories and evidence about evolution it was not allowed to be taught at the school or even mentioned. In that case, I believe that the opinion played a negative role in my life as well as other students lives because we ended up not having knowledge about something that are constantly brought up in all upper division science courses. I think if the school was to teach us about evolution and then state their opinions it would've been a different story, but they didn't even allow us to make our own bias off the topic. I just firmly believe that opinion can mostly affect science negatively because science is not based on opinion its based on evidence and using the scientific method. Everyone has an opinion and I do respect everyone's opinion, but lets leave out opinions sometimes when it comes to science!

Protein Synthesis

CCGCCCATACCAAGTAAGTGTTAGCGGGAACGGACCGCATATCGAATCCG

Darwin's Evolution Theory

     I believe that Charles Lyell had one of the biggest influences on Darwin's theory of Natural selection. A huge contribution that Lyell made to the science community is that he was the modern founder of geology. He also wrote the book Principles of Geology, which argued the idea of uniformitarianism. Uniformitarianism is a geological principle that states that the Earth has been shaped by roughly the same forces seen today (PBS). It considers that these geological processes are unaltered from the those of the past. The slogan they use for uniformitarianism is "the present is the key to the past" (PBS). This work formed the foundation that Earth could be billions of years old.
http://www.pbs.org/wgbh/evolution/library/02/4/l_024_01.html
    The work of Charles Lyell helped Darwin's theory of natural selection. The bullet point "Individuals do not evolve. Populations do" has been influenced by Lyell because Darwin's concept of slow and gradual evolution was formed with the help of Lyell's work on old-earth theories. This bullet point states that evolution does not occur within a generation but between a generation meaning it takes time for evolution to occur. Lyell's old-earth theories gave Darwin's gradual evolution theory an adequate period of time, because Lyell's theory of the Earth being extremely old supports Darwin's theory of life taking many years to change. 
     I do not believe that Darwin could have developed a believable natural selection theory without Charles Lyell. Charles Lyell not only mentored Darwin but gave his theory a lot of support and an actual time frame for gradual evolution. Without the concept of the Earth being possibly a billion years old it would be harder to understand. I do believe that Lyell's ideas were very much used by Charles Darwin himself while developing the famous theory of evolution.
    The attitude of the church directly affected Darwin and his decision not to publish his theory for a while because his wife Emma had very strong religious beliefs, and he knew that this theory would not be accepted in the church and would cause threats to his friends and family (37).
Jurmain, Robert. Introduction to physical anthropology. Wadsworth Cengage learning, 2014.